Note: Descriptions are shown in the official language in which they were submitted.
CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 METHOD AND ITS COMPOSITIONS FOR DETECTION OF NUCLEIC ACID TARGET FROM BIOLOGICAL SAMPLES AND BODY FLUIDS FIELD OF THE INVENTION The invention is directed to compositions and method for rapid biological sample pretreatment that allows following nucleic acid amplification based detection of the target nucleic acid from biological samples and body fluids. BACKGROUND OF THE INVENTION Current diagnostics relies majorly on the nucleic acid amplification techniques (NAAT). Most commonly known method for specific DNA amplification is PCR that gives reasonable sensitivity on the laboratory level. Lately new emerging techniques have been developed of isothermal amplification, such as recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), helicase dependent amplification (HDA). These isothermal NAATs do not require thrermocycling of the reaction and have shown extremely high levels of sensitivity, resulting in detectable amplification product from as few as 1-2 template copies. Isothermal reaction makes them well suited for point-of-care (POC) settings (eg GP office, at home), bringing diagnostics test conveniently and immediately to the patient and decreasing time to result. In the field of sexually transmitted diseases, POC diagnostics also allows private and non-invasive testing, that has a potential to significantly reduce the spread of the pathogens, especially those that exist in asymptomatic form like C. trachomatis and M. genitaium. Both M. genitalium and C. trachomatis infections are known as "silent" diseases as they often remain asymptomatic. Thus regular diagnostic screening of these sexually transmitted pathogens is of high importance. Classically C. trachomatis infection has been diagnosed from urethral or cervical swab specimens by tissue culture method. Because culturing identifies only viable C. trachomatis cells, sensitivity of the diagnostics is affected by the freshness of the specimen depending on the time between collection and processing in the laboratory. Thus during 1980s antigen and nucleic acid detection technologies have been developed for C. trachomatis diagnostics that have lesser demand of cost, time, expertise, preservation of infectivity during transport. Furthermore nucleic acid detection techniques have proved to have much higher sensitivity levels as they CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 2 can detect pathogen DNA from unviable cells or cell debris. Microbiological detection of M. genitalium is also mostly performed by specific amplification of the pathogen DNA by PCR. M. genitalium culture is extremely difficult and is not performed routinely. Serological detection methods of M. genitalium are weakly sensitive and specific. Although NAAT open up crucial opportunity for highly effective diagnostics, to date they are routinely used only on the laboratory level. NAATs are complicated to perform, require trained personnel and expensive machinery. Thus NAAT based diagnostics is centered to large hospitals and diagnostics centers. One of the major limitations of the NAAT techniques is the requirement for pure DNA sample. The purity of the sample can affect significantly performance of the NAAT-s, especially PCR. Novel isothermal NAAT-s like RPA, LAMP, HDA etc seem to be less sensitive towards nucleic acid sample purity and are able to efficiency amplify DNA present in eg human urine samples. Current invention discloses a method and its compounds for biological sample pretreatment that allows efficient release of the genomic DNA from cellular material. Described sample pretreatment method is compatible with the following nucleic acid amplification procedure allowing detection of the target DNA from crude sample lysates. The invention allows skipping of the DNA purification step prior to NAAT analysis, having therefore an important impact on the complexity and speed of the diagnostic technique. Current invention facilitates significantly implementation of the highly sensitive and specific NAAT diagnostics in the POC settings. Because examples of the invention implementation is concentrated on human sexually transmitted pathogen diagnostics, the overview of the Chlamydia trachomatis and Mycoplasma genitalium will be given hereafter. C. trachomatis and M. genitalium are sexually transmitted human pathogens. Both of them are associated with non-gonococcal (non-specific) urethritis in men and several inflammatory reproductive tract syndromes in women such as cervicitis and pelvic inflammatory disease. Inflammatory diseases caused by acute untreated infections of C. trachomatis and M. genitalium are one of the leading causes of female infertility worldwide. CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 3 The prevalence of M. genitalium ranges globally from 1-4% in men and 1-6% in women. Reported prevalence data within populations at higher risk (eg within sexually transmitted disease (STD) testing centers) reach 38%. C. trachomatis prevalence rates among sexually active young people vary from 5-10% depending on the age, ethnic origin etc. C. trachomatis infection is almost always more prevalent among women and has shown an increasing trend globally during past decades. M. genitalium is a small (0.2-0.3 pm) pleomorphic bacterium that lacks cell wall making it resistant to common antibiotics targeting cell wall (eg penicillin). M. genitalium cells are flask shaped and carry a specific adhesion organelle that allows bacteria to adhere to various materials and cells including human epithelial cells. Adhesion is the main mechanism of M. genitalium pathogenesis that involves at least seven adhesins including major adhesin MgPa (encoded by MGPB gene). C. trachomatis is a gram-negative, obligate intracellular pathogen that has a unique biphasic developmental cycle during which they exist in two developmental forms: the EB (or elementary body) and RB (or reticulate body). EB is smaller (0.2 pM), metabolically inactive, infectious extracellular form of the organism and RB is larger (0.8 pM) metabolically active intracellular form. Chlamydial infection involves attachment of the EB to a host cell and its subsequent internalization into a membrane-bound vesicle. Inclusion differentiates into RB which uses host cell ATP and metabolites to undergo 8-12 round of cell division. RB differentiates and matures into infectious EB that are released by host cell lysis. C. trachomatis strains are serologically classified into 15 serovars based on antigenic variation of the major outer membrane protein. A-C serovars are eye pathogens causing ocular trachoma. Serovars D-K and L1-L2 are sexually transmitted pathogens that infect columnar epithelial cells of the genital tract. Adaptive immunity against C. trachomatis involves INF-y mediated host cell responce that deprives chlamydial RBs of tryptophan, which ultimately prevents their growth and replicative capabilities. C. trachomatis genital serovars have retained some of the eubacterial tryptophan biosynthesis genes, TRPA and TRPB encoding a and 13 subunits of the tryptophan synthase that catalyzes conversion of the indole into tryptophan. Thus genital C. trachomatis serovars have retained the CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 4 capacity to use exogenous indole secreted by genital trakt normal microflora that allows them to overcome INF-y mediated growth restriction and promotes long term establishment of the infection. M. genitalium has a small AT rich (68%) 0.58 Mb genome that encodes 485 genes. Despite its small size, 4% of the genome consists of repeated elements (MgPa repeats) that present homology with the MGPB gene. C. trachomatis also carries a small genome of approximately 1Mb chromosome and 7.5 kb cryptic plasmid. Almost all C. trachomatis strains harbor four to ten plasmid copies per chromosome. Although some plasmid-free C. trachomatis isolates have been described, their virulence is significantly reduced as compared to the plasmid carrying strains. Chlamydia plasmid sequence is highly conserved (< 1% variation) and contains eight major coding sequences (CDSs) along with a replication origin formed by four 22 bp tandem repeats. In silico analysis has identified plasmid encoded proteins to have a function in replication. DESCRIPTION OF THE INVENTION Current invention discloses a method and its compounds for biological sample pretreatment that allows efficient release of the genomic DNA from cellular material. Major advantage of the described sample pretreatment method is its compatibility with downstream nucleic acid amplification procedures allowing detection of the target DNA from crude sample lysates. Thus current invention allows skipping of the DNA purification step prior to NAAT analysis, having therefore an important impact on the complexity and speed of the diagnostic technique. The invention discloses cell lytic compounds that allow fast (within 5 min at RT C) and efficient release of the genomic material from mammalian cells, their pathogen and commensal microorganisms, bacterial and fungi cultures etc. Sample pretreatment buffer consists of membrane active (cell-penetrating) peptides, mild detergents or a combination of the above two. Membrane active peptides have antibacterial and antimicrobial effect acting disruptively on bacterial membranes. They are also known as cell membrane penetrating agents that can deliver different cargo molecules into mammalian cells (eg oligonucleotides, siRNA, plasmids, peptides). Current invention targets novel CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 usage of the cell-penetrating peptides for diagnostics purposes. At higher (pM - mM) concentrations cell-penetrating peptides disrupt cellular membranes, that allows the release of the genomic DNA that can be used as a target in the following nucleic acid amplification reaction. Cell membrane disruptive peptides 5 have shown no or minimal inhibiting effect on nucleic acid amplification even at high concentrations, thus can be efficiently used as agents facilitating genomic material release. Detergents are very good solubilizing agents, but they tend to denature proteins by destroying native three dimensional structures. Certain combination of the mild ionic or non-ionic detergents (eg Triton X-100, Triton X-114, NP-40, CHAPS, Octy1-3-glucoside, Octy1-3-thioglucopyronoside) at low (eg 0.1-1%) concentration allow efficient cell wall disruption in order to release genomic material enclosed within cells. These mild detergents do not interfere significantly with nucleic acid amplification procedure, and are able to induce or facilitate the release of the sufficient amount of the target nucleic acid. The composition and concentration of the detergents is set to efficiently lyse cells within 5 min RT C incubation. The ability of the membrane active peptide and/or detergent mediated sample pretreatment to convert biological sample into material well usable for the nucleic acid amplification is the major focus of the invention and has been confirmed by establishing detection of the Chlamydia trachomatis, Mycoplasma genitalium and Homo sapiens genomic DNA from crude human urine lysates. For that a diagnostic method for highly specific and sensitive C. trachomatis and M. genitalium detection from human samples has been developed based on isothermal nucleic acid amplification (RPA, LAMP) and including immunochromotographic product detection using lateral-flow strips. For both pathogens we have used double target system, where simultaneous detection of two different genomic targets is performed. This reduces probability of the false negative diagnostics test result in case deletions or mutations are introduced into pathogen genomic DNA regions used as the amplification targets. All target regions were selected based on their high homology among different pathogen strains and lack of identity with similar species. CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 6 For C. trachomatis detection we have used genomic sequence regions from a well-established diagnostic target ¨ coding sequence 2 of the multicopy cryptic plasmid (CDS2). For the second target we have chosen 33 subunit of the tryptophan synthase gene TRPB. For M. genitalium detection we have used genomic sequence regions from gene encoding MgPa dominant adhesin (MGPB) that is the main component of multiple repeats throughout its genome. For the second target we used 16S rRNA gene that is also present in multiple copies within M. genitalium genome. M. genitalium 16S rRNA gene however is highly conserved between different Mycoplasma species (eg 98% identity with M. pneumoniae, 91% with M. gallisepticum). Thus multiple mutations containing regions were chosen for the isothermal amplification and additional specificity testing was performed for this particular target. For each target, optimal primer pair combinations were established that enable highest sensitivity levels for the assay. Optimized RPA reaction allowed well detectable and stable product amplification with minimum of 20-50 target sequence copies. Optimized LAMP reaction with loop primers allowed product amplification with minimum of 5-10 target sequence copies. Each diagnostics target was tested for specificity of the reaction with 50 000 copies (0.16 ng) of H. sapiens genomic DNA and in case of M. genitalium 16S rRNA target also with 100 000 copies of M. pneumoniae genomic DNA. Isothermal amplification sensitivity and specificity was verified with total DNA extracted from human urine samples. Major objective of the current invention was to develop a diagnostic assay applicable under point-of-care conditions. Thus we have integrated immunochromotographic amplification product detection into the diagnostics system. For that purpose, forward primer sequences were 5' labeled with biotin and reverse primers with fluorescein amidite (FAM). During amplification reaction a dually labeled products were produced, that were detected within minutes using lateral-flow strips. Integration of the innmunochromotographic product detection required additional primer optimization. Primers gaining template independent lateral-flow strip detectable signal were eliminated from the selection. RPA and LAMP isothermal amplification based diagnostics methods were also showed to be suitable for simultaneous multiple target detection. Both assays CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 7 were optimized for H. sapiens GAPDH gene target to be used as a positive control of the diagnostics test with human samples. PCR and isothermal amplification (RPA/LAMP/HDA) protocols were adjusted for optimal sensitivity and high specificity of the diagnostics test. The present method for detection of nucleic acid target(s) from biological crude samples and body fluids comprises following steps: a) sample pretreatment comprising cell lysis and release of nucleic acid targets in biological samples and body fluids such as tissue, urine, saliva, blood, stool, hair, etc. and their derivatives, but not limited to the examples list, wherein the lytic peptides are used to release nucleic acid targets in biological samples; b) amplification of nucleic acid(s) comprising nucleic acid, such as DNA, RNA and their derivatives but not limited to the list, amplification initiated by presence of target and comprise amplification methods such as PCR (Polymerase Chain Reaction), HCR (Hybridization Chain Reaction), RCA (Rolling Circle Amplification), RPA (Recombinase Polymerase Amplification), LAMP (Loop mediated isothermal AMPlification), HDA (Helicase Dependent Amplification), etc. and their derivatives, but not limited to the examples list, wherein one or more specific target based sequences are amplified or sample solution obtained during the step (1) is directly subjected for further amplification procedure; C) detection of amplification product(s) comprising the use of qualitative or quantitative detection methods such as sandwich assays, ELISAs (Enzyme Linked ImmunoSorbent Assay), LF (Lateral Flow) immunochromatographic assays, wavelength changing (visible spectrum, chemiluminescence, fluorescence, phosphorescence and etc.) dyes, denrimeres, etc. or corresponding moiety conjugated detector molecules and ligands, with or without optical apparatus, appropriate wavelength emitter or reader or their combination, wherein qualitative and quantitative detection is performed with crude sample solution. The pretreatment method is specifically designed to detect nucleic acid target(s): - of Chlamydia trachomatis with the use of specific target region provided in Table 1 or with the use of specific primer(s) and/or its labeled derivative(s) sequences provided in Table 2, 3; and CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 8 - Mycoplasma genitalium with the use of specific target region provided in Table 1 or with the use of specific primer(s) and/or its labeled derivative(s) sequences provided in Table 2, 3. The present method with human genomic GAPDH target is used for detection: - as an internal validation and platform assessing technique; - as an internal validation and platform assessing technique with specific primer(s) and/or its labeled derivative(s) sequences provided in Tables 2, 3. The pretreatment method that relates to molecular diagnostics of Chlamydia trachomatis wherein TRPB gene is used as molecular diagnostics target. EXAMPLES OF THE IMPLEMENTATION Example 1. Fast diagnostics of the presence of Chlamydia trachomatis in a urine sample Present protocol describes method and its components for highly sensitive Chlamydia trachomatis diagnostics from human urine sample. The whole procedure including sample pretreatment, target isothermal amplification and product detection takes under 20 min and requires 10 min incubation at 37 C. Described method detects two C. trachomatis targets TRPB sequence in the genomic region and CDS2 sequence in the cryptic plasmid region (Table 1). Table 1. Genomic regions of Chlamydia trachomatis, Mycoplasnna genitalium and Homo sapiens used for isothermal amplification based detection Target organism Sequence name Genebank accession nr PL CDS2 FM865439.1 C. trachomatis - sequence 756-1748 FN652779.2 TRPB sequence 193461-194639 16S rRNA CP003773.1 sequence 169843-1 71 366 M. genitalium CP003773.1 MGPA sequence 221365-225744 H. sapiens GAPDH NG 007073.2 Both of the C. trachomatis targets are amplified using highly specific and sensitive primers that carry same labeling, forward primers are labeled with biotin and reverse with FAM. Thus C. trachomatis specific products are not distinguished during immunochromatographic detection on lateral-flow strips. Detection of the CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 9 two C. trachomatis regions is used to ensure positive test results in case one of the target regions is mutated or deleted. The reaction also contains primers targeting H. sapiens GAPDH gene that produce DIG and FAM labeled product. This product is recognized as a separate lane on the lateral-flow strip and serves as a positive control for the whole procedure (release of the genomic material from cells, amplification and detection). Analytical sensitivity of the described method is 50 C. trachomatis cells and 50 H. sapiens cells per test. This allows detection of the C. trachomatis in the first void urine at pathogen concentration of 10 000 cells per 1 ml of urine or higher. Patient urine sample is mixed with equal volume of sample pretreatment buffer containing 0.2% Triton X-114, 150 mM NaCl, 50 mM Tris pH 7.0, and incubated 5 min at RT C. 10 pl of the treated sample is used in the RPA reaction containing following components: C. trachomatis PL-CDS2 5' biotin labeled FW3 primer at 0.4 pM final concentration, C. trachomatis PL-CDS2 5' FAM labeled RV1 primer at 0.4 pM final concentration, C. trachomatis TRPB 5' biotin labeled FW2 primer at 0.4 pM final concentration, C. trachomatis TRPB 5' FAM labeled RV3 primer at 0.4 pM final concentration, H. sapiens GAPDH 5' DIG labeled FW3 primer at 0.4 pM final concentration, H. sapiens GAPDH 5' FAM labeled RV2 primer at 0.4 pM final concentration (see Table 2 for primer sequences), 14 mM magnesium acetate, TwistDX RPA enzyme pellet and 29,5 pl of the rehydration buffer. Reaction is incubated at 37 C for 10 min. The products are diluted 1:10 ratio with dilution buffer and analyzed on lateral-flow strips detecting Biotin-FAM and DIG-FAM labeled molecules. Table 2. Specific primer sequences for recombinase polymerase amplification (RPA) against targets provided in Table 1 Target Sequence (5' ¨ 3') organism and region C. Forward FW1 5' ¨ trachomatis (FW) CTTCTTTGAAGCGTTGTCTTCTCGAGAAGATTT PL-CDS2 primer FW2 5' - sequences CTTCTCGAGAAGATTTATCGTACGCAAATATC FW3 5' - CCTTCATTATGTCGGAGTCTGAGCACCCTAGGC FW4 5' - AGGCGTTTGTACTCCGTCACAGCGGTTGCTCG CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 Reverse RV1 5'- (RV) CTCTCAAGCAGGACTACAAGCTGCAATCCCTT primer RV2 5' - sequences ATGGTGGGGTTAAGGCAAATCGCCCGCACGTT RV3 5'- TCT TCG TAA CTC GCT CCG GM AAA TGG TGG GG RV4 5'- CTT TCT ACA AGA GTA CAT CGG TCA ACG AAG AGG C. Forward FW1 5'- ACT ATG CGG GGA GAC AM CTC CTC trachomatis (FW) TGA CTG MG TRP B primer FW2 5'- TCT TM ACG CGA AGA TCT UT GCA sequences TAC AGG AGC FW3 5'- CAT ACA GGA GCA CAT AM CTG MT MT GCT CU GG FW4 5'- CTC TTG GTC AGT GTT TGC TTG CTA AAT ATC TTG Reverse RV1 5'- TCC CCC ACC TGT TTC AGC TAC MC (RV) ACG TGT TT primer RV2 5'- CTG TTG CTG TTG CTA CTC CAT GTT sequences GTC CCG CAC RV3 5'- TCC CAT GTA TAC TAC ACA ATC TM TCC TAG ATA RV4 5'- TTC TGT CGT TCC ACA TCT TTT GCT CCC ATG TAT M. Forward FW1 5'- AGC GCA ACC CTT ATC GTT AGT TAC genitalium (FW) ATT GTT TM 1 6S rRNA primer FW2 5'- CGT TAG TTA CAT TGT TTA ACG AGA sequences CTG CTA ATG T FW3 5'- ACG TGC TAC MT GGC CM TAC AM GAG TAG CCA A Reverse RV1 5'- TTG CAG CCC TCA ATC CGA ACT GAG (RV) ACC AAC TTT T primer RV2 5'- CAT AGC TGA TTC GCG ATT ACT AGT sequences GAT TCC AGC RV3 5'- TTC CM TAA AGG TTA GCA ACA OCT TTT TAA ATA M. Forward FW1 5' ¨ genital ium (FW) TTGGACTTGAAACAATAACAACTTCTCTTCACT MGPA primer FW2 5' ¨ sequences AAGATTACTGGAGAGAACCCAGGATCATTTGGA FW3 5'- GAG TGG GCA GAC TAT GTC TTA OCT TTG ATT GTA FW4 5'- TTA TCC TTA GTG TTA CU TGG GAT TAA CGA TTG G FW5 5'- CAATGCACAGAAACAAAAAGGCATTACAAGCAGG Reverse RV1 5'- TCT GAT TGC AAA GTT TTG CTG ACC (RV) ATC AAG GTA CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 11 primer RV2 5'- CTC TAC CGT TGT TAT CAT ACC TTC sequences TGA TTG C RV3 5'- TTC TGT TAA TGA TCT CTT TAA AGA CAC TAC CAA RV4 5'- CTT AGG AGC GTT AGA GAT CCC TGT TCT GTT AAT G RV5 5'- CTT GTT TTA ACT TCT TAG GAG CGT TAG AGA TCC C RV6 5'- TTACTGGAGGTTTTGGTGGGGTTTTAGGAGTTGG H. sapiens Forward FW1 5' - GAPDH (FW) CTCCTCCGGGTGATGCTTTTCCTAGATTATTCTC primer FW2 5' - CTA ACC CTG CGC TCC TGC CTC GAT sequences GGG TGG AG FW3 5'- AAG TCA GGT GGA GCG AGG CTA GCT GGC CCG ATT Reverse RV1 5'- TCC UT TCC MC TAC CCA TGA CTC (RV) AGC TTC TCC C primer RV2 5'- CAC CAT GCC ACA GCC ACC ACA CCT sequences CTG CGG GGA RV3 5'- CCA CCA CCA GAG GGG CCA TTT TGC GGT GGA AAT Chlamydia tests positive if the test gives 2 lines (Biotin-FAM and DIG-FAM), negative if the test gives 1 line DIG-FAM. The results of the test are invalid if none of the lines are present or only iotin-FAM line is present. Example 2. Fast diagnostics of the presence of Mycoplasma genitalium in a urine sample Present protocol describes method and its components for highly sensitive Mycoplasma genitalium diagnostics from human urine sample. The whole procedure including sample pretreatment, target isothermal amplification and product detection takes under 20 min and requires 10 min incubation at 37 C. Described method detects two M. genitalium targets MGPA and 16S rRNA sequences in the pathogen genome (Table 1). Both of the M. genitalium targets are amplified using highly specific and sensitive primers that carry same labeling, forward primers are labeled with biotin and reverse with FAM. Thus M. genitalium specific products are not distinguished during immunochromatographic detection on lateral-flow strips. Detection of the two M. genitalium regions is used to ensure positive test results in case one of the target regions is mutated or deleted. The reaction also contains CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 12 primers targeting H. sapiens GAPDH gene that produce DIG and FAM labeled product. This product is recognized as a separate lane on the lateral-flow strip and serves as a positive control for the whole procedure (release of the genomic material from cells, amplification and detection). Analytical sensitivity of the described method is at least 50 M. genitalium cells and 50 H. sapiens cells per test. This allows detection of the M. genitalium in the first void urine at pathogen concentration of 10 000 cells per 1 ml of urine or higher. Patient urine sample is mixed with equal volume of sample pretreatment buffer containing 0.2% NP-40, 150 mM NaCl, 50 mM Tris pH 7.0, and incubated 5 min at RT C. 10 pl of the treated sample is used in the RPA reaction containing following components: M. genitalium MGPA 5' biotin labeled FW4 primer at 0.4 pM final concentration, M. genitalium MGPA 5' FAM labeled RV4 primer at 0.4 pM final concentration, M. genitalium 16S rRNA 5' biotin labeled FW1 primer at 0.4 pM final concentration, M. genitalium 16S rRNA 5' FAM labeled RV1 primer at 0.4 pM final concentration, H. sapiens GAPDH 5' DIG labeled FW3 primer at 0.4 pM final concentration, H. sapiens GAPDH 5' FAM labeled RV2 primer at 0.4 pM final concentration (see Table 2 for primer sequences), 14 mM magnesium acetate, TwistDX RPA enzyme pellet and 29,5 pl of the rehydration buffer. Reaction is incubated at 37 C for 10 mind The products are diluted 1:10 ratio with dilution buffer and analyzed on lateral-flow strips detecting Biotin-FAM and DIG-FAM labeled molecules. M. genitalium tests positive if the test gives 2 lines (Biotin-FAM and DIG- FAM), negative if the test gives 1 line DIG-FAM. The results of the test are invalid if none of the lines are present or only Biotin-FAM line is present Example 3. Highly sensitive diagnostics of the presence of Chlamydia trachomatis from a patient sample extracted total DNA. Present method uses highly sensitive loop mediated isothermal amplification (LAMP) for specific detection of C. trachomatis DNA. Analytical sensitivity of the described method is at least 5 C. trachomatis cells per test. LAMP reaction is prepared as follows: C. trachomatis PL-CDS2 SET4 primers F3 and B3 at 0.2 pM concentration each, C. trachomatis PL-CDS2 SET4 5' biotin labeled FIP and 5' FAM labeled BIP primers at 1.6 4M each, C. trachomatis PL-CDS2 SET4 5' biotin CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 13 labeled LF and 5' FAM labeled LB loop primers at 0.8 jiM each (see Table 3 for primer sequences), 5.6 ILIM dNTP, 6 mM MgSO4, 0.8 M betain, 8 units of Bst polymerase, 2.5 jil of 10x Bst polymerase buffer and 5 1_11 of total DNA extracted from patient sample per 25 41 reaction. Incubate reaction for 1 h at 63 C, dilute diluted 1:10 ratio with dilution buffer and analyzed on lateral-flow strips detecting Biotin-FAM labeled molecules. In a parallel reaction C. trachomatis TRPB targeting LAMP can be performed with SET1 primers (Table 3) for additional positive control (with analytical sensitivity of at least 5 C. trachonnatis cells per test). Additionally H. sapiens GAPDH targeting LAMP with SET 1 primers (Table 3) could be used as a positive control of the reaction. Table 3. Specific primer sequences for loop mediated isothermal amplification (LAMP) against targets provided in Table 1 Target Sequence (5' ¨ 3') organism and region C. SET 1 F3 GCTTGTTGGAAACAAATCTGA trachoma B3 TCGAACATTTTTTAAAACCAGG tis PL- FIP GATCGCCCAGACAATGCTCCTAATCTCCAAGCTTAAG CDS2 ACTTCA BIP AACCAATCCCGGGCATTGATAAAAACGGATGCGATGA AC SET 2 F3 AAAGTGCATAAACTTCTGAGG B3 CTAAAAAAAATCAATGCCCGG Fl P TGTTTCCAACAAGCTACCATTTCTTATAATCCTCTTTT CTGTCTGACG BIP AATCTCCAAGCTTAAGACTICAGAGATTGGTTGATCG CCCAGA SET 3 F3 TCTAAAGACAAAAAAGATCCTCG B3 TGTGATGGGTAAAGGGATT FIP GCATGAAAAGCTTCTCCTTATTCGAATGATCTACAAGT ATGTTTGTTGAG BIP CCAATAGGATTCTTGGCGAATTTTTTGCAGCAAGAAA TGTCGTTA SET 4 F3 CGACTATTTTCTTGTTTAGAAGGTT B3 GAAAAGATTGGTCTATTGTCCT Fl P AGCAGCAAGCTATATTTCCTTAACAGCTATAGCGACT ATTCCTTGA CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 14 BIP GTCTTGGCAGAGGAAACTTTTTTAATGGATATGAATCT GCAAGAGTT LF1 GATTC,CTAAACAGGATGAC LB1 TCGCATCTAGGATTAGAT LF3 AGATTCCTAAACAGGATGAC LB2 CGCATCTAGGATTAGATTATG SET 5 F3 AATATCATCTTTGCGGTTGC B3 TCTACAAGAGTACATCGGTCA FIP TCGAGCAACCGCTGTGACGACCTTCATTATGTCGGAG TC BIP GCAGCTTGTAGTCCTGCTTGAGTCTTCGTAACTCGCT CC LF TAC AAA CGC CTA GGG TGC LB CGG GCG ATT TGC CTT AAC C. SET 1 F3 GCA GTT GCA GGA AGA GAT C trachomati B3 GTC ATC TTG AAG AAG ATA CGA A s TRPB FIP GGA CTT TTG GAT TCG GGA TAA AAT GCT GAT AU CTG ATT GCA TGT ATC G BIP GGA GGA CTG GGC ATT TCT TCA TGG AAT ACT CCA GGT CGC [Fl AGCGTTGGAGCCACCTC LB1 GAAAACATGCAGCACGTTTTGCA LF2 CAATAGCGTTGGAGCCACCT LB2 AACATGCAGCACGTTTTGCA SET 2 F3 CAAGATGACGATGGACAAGT B3 CCAGATAAGTTAACGATGACGA FIP GGCTCGTCCTGACTCATGCTCCGCTGGATTAGATTAT CCT BIP CCGATGAAGAGGCGTTACGAGGAGCATGTGAAGA CTCCAAT LF CAT GAT CTG GCC CM CTG A LB TCC TGC TTA CTA GM ATG AGG G M. SET 1 F3 ATTGGTTAACTTACCTAGTGGC genitalium B3 ACTTCTTAGGAGCGTTAGAGA MGPA FIP GACATAGTCTGCCCACTGGTTGATCCTCAAACCCAAC AGTT BIP AGGCATTACAAGCAGGGTTTGAAAGACACTACCAACT GCTT LF AAAGGGTTGAAAGACAGTTTGG LB AAGGTTGATGTCTTGACCA SET 2 F3 CACCTTACCAGTAACTGAACT B3 AACCCTGCTTGTAATGCC FIP TTAAGCGGATTGAAGCTTGATCTGTCTATGACCAGTA TGTACCA BIP CCCAACAGTTTATCCCGGTACTAAGGTAAGACATAGT CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 CTGCC LF GCCACTAGGTAAGTTAACCAAT LB AATGCATCAAGTACAGGTCC SET 3 F3 CACCTTACCAGTAACTGAACT B3 AACCCTGCTTGTAATGCC El P TTAAGCGGATTGAAGCTTGATCTCTATGACCAGTATG TACCACT BIP CCCAACAGTTTATCCCGGTACTAAGGTAAGACATAGT CTGCC LF GCCACTAGGTAAGTTAACCAAT LB AATGCATCAAGTACAGGTCC SET 4 F3 CACCTTACCAGTAACTGAACT B3 AACCCTGCTTGTAATGCC Fl P TTAAGCGGATTGAAGCTTGATCGTCTATGACCAGTAT GTACCAC BIP CCCAACAGTTTATCCCGGTACTAAGGTAAGACATAGT CTGCC LF GCCACTAGGTAAGTTAACCAAT LB AATGCATCAAGTACAGGTCC SET 5 F3 GATCCTCAAACCCAACAGTT B3 TTAGGAGTTGGTTTGGTTGG F IP GACATAGTCTGCCCACTGGTTTGCATCAAGTACAGGT CC BIP AGGCATTACAAGCAGGGTTTGAACTTCTTAGGAGCGT TAGAGA LF AAAGGGTTGAAAGACAGTTTGG LB AAGGTTGATGTCTTGACCAA SET 6 F3 TGTCTATGACCAGTATGTACCA B3 AACCCTGCTTGTAATGCC Fl P ACTGTTGGGTTTGAGGATCTTTATTGGTTAACTTACCT AGTGGC BIP CCCGGTACTAAATGCATCAAGTAAGGTAAGACATAGT CTGCC LF TTAAGCGGATTGAAGCTTGATC LB CCAAACTGTCTTTCAACCCTTT SET 7 F3 CACCTTACCAGTAACTGAACT B3 AACCCTGCTTGTAATGCC F IP TTACCTTTAAGCGGATTGAAGCTGACCAGTATGTACC ACTATTG = BIP CCCAACAGTTTATCCCGGTACTAAGGTAAGACATAGT CTGCC LF GATCAAAGCCACTAGGTAAGTT LB AATGCATCAAGTACAGGTCC SET 8 F3 CTATGACCAGTATGTACCACTA B3 AACCCTGCTTGTAATGCC Fl P ACTGTTGGGTTTGAGGATCTITTTGGTTAACTTACCTA GTGGC B I P CCCGGTACTAAATGCATCAAGTAAGGTAAGACATAGT CTGCC CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 16 LF TTAAGCGGATTGAAGCTTGATC LB CCAAACTGTCTTTCAACCCTTT SET 9 F3 TGACCAGTATGTACCACTAT B3 AACCCTGCTTGTAATGCC F IP ACTGTTGGGTTTGAGGATCTTTTGGTTAACTTACCTAG BIP CCCGGTACTAAATGCATCAAGTAAGGTAAGACATAGT CTGCC LF TTAAGCGGATTGAAGCTTGATC LB CCAAACTGTCTTTCAACCCTTT SET F3 TGACCAGTATGTACCACTATTG B3 AACCCTGCTTGTAATGCC FIP ACTGTTGGGTTTGAGGATCTTTGTTAACTTACCTAGTG GCTT BIP CCCGGTACTAAATGCATCAAGTAAGGTAAGACATAGT CTGCC LF TTAAGCGGATTGAAGCTTGATC LB CCAAACTGTCTTTCAACCCTTT SET E3 GACCAGTATGTACCACTATT 11 B3 AACCCTGCTTGTAATGCC F IP ACTGTTGGGTTTGAGGATCTTTGGTTAACTTACCTAGT GGCTT BIP CCCGGTACTAAATGCATCAAGTAAGGTAAGACATAGT CTGCC LF TTAAGCGGATTGAAGCTTGATC LB CCAAACTGTCTTTCAACCCTTT M. SET 1 F3 CGTGAACGATGAAGGTCTT genital urn B3 ACCACACTCTAGACTGATAGTT 16S rRNA FIP GCGACTGCTGGCACATAGTTAAGAATGACTCTAGCAG GCA BIP ACATAGGTCGCAAGCGTTATCCCTGCCTTTAACACCA GACTT LF GTACt GTCAAACTCCAGCCA LB GGATTTATTGGGCGTAAAGCAA SET 2 E3 CGTGAACGATGAAGGTCTT B3 ACCACACTCTAGACTGATAGTT FIP GCGACTGCTGGCACATAGTAATGACTCTAGCAGGCA ATG BIP ACATAGGTCGCAAGCGTTATCCCTGCCTTTAACACCA GACTT LF TGGTACAGTCAAACTCCAGC LB _ GGATTTATTGGGCGTAAAGCAA SET 3 F3 CGTGAACGATGAAGGTCTT B3 ACCACACTCTAGACTGATAGTT F IP GCTGGCACATAGTTAGTCGTCAGAAGAATGACTCTAG CAGGC BIP ACATAGGTCGCAAGCGTTATCCCTGCCTTTAACACCA GACTT LF GTACAGTCAAACTCCAGCCA CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 17 LB GGATTTATTGGGCGTAAAGCAA SET 4 F3 CGTGAACGATGAAGGTCTT B3 ACCACACTCTAGACTGATAGTT F IP GCGACTGCTGGCACATAGTTAGAATGACTCTAGCAG GCAAT BIP ACATAGGTCGCAAGCGTTATCCCTGCCTTTAACACCA GACT7 LF TGGTACAGTCAAACTCCAGC LB GGATTTATTGGGCGTAAAGCAA SET 5 F3 CATTACTGACGCTTAGGCTT B3 GCCAAGGATGTCAAGTCTAG F IP CTTCACTACCGAAGGGATCGCCCTAGTAGTCCACACC GTAA BIP GCCTGGGTAGTACATTCGCAAAACATGCTCCACCACT TG LF TCCGACAGCTAGTATCTATCGT LB TGAAACTCAAACGGAATTGACG SET 6 F3 CGTGAACGATGAAGGTCTT B3 ACCACACTCTAGACTGATAGTT FIP GCGACTGCTGGCACATAGTGACTCTAGCAGGCAATG BIP ACATAGGTCGCAAGCGTTATCCCTGCCTTTAACACCA GACTT LF AAAGTGGTACAGTCAAACTCCA LB GGATTTATTGGGCGTAAAGCAA SET 7 F3 CAAGTGGTGGAGCATGTT B3 TCCCTTCCTTCCTCCAATT FIP CGACAACCATGCACCACCTCTAGACTTGACATCCTTG GC BIP CAGCTCGTGTCGTGAGATGTTTAACTAACGATAAGGG TTGCG LF GTCACTCGGTTAACCTCCATT LB GGTTAAGTCCCGCAACGA SET 8 F3 AATGACTCTAGCAGGCAATG B3 ACCACACTCTAGACTGATAGTT F IP CGGATAACGCTTGCGACCTTAAGTGACGACTAACTAT GTGC BIP AAGCGCAGGCGGATTGAACCAATGCATACAACTGTTA AGC LF TGTATTACCGCGACTGCTG LB AGTCTGGTGTTAAAGGCAGC SET 9 F3 AATGACTCTAGCAGGCAATG B3 ACCACACTCTAGACTGATAGTT FIP CGGATAACGCTTGCGACCTAAGTGACGACTAACTATG TGC BIP AAGCGCAGGCGGATTGAACCAATGCATACAACTGTTA AGC LF TGTATTACCGCGACTGCTG LB AGTCTGGTGTTAAAGGCAGC CA 02888949 2015-04-21 WO 2014/060604 PCT/EP2013/071906 18 SET F3 CAAGTGGTGGAGCATGTT B3 GTTTGCAGCCCTAGACATAA FIP CGACACGAGCTGACGACAACCTTGGCAAAGTTATGG AAAC BIP TGGGTTAAGTCCCGCAACGCCAATTTACATTAGCAGT CTCG LF CATGCACCACCTGTCACT LB CGCAACCCTTATCGTTAGTTAC SET F3 CGCATAAGAACTTTAGTTCGC 11 B3 AAGACCTTCATCGTTCACG FIP TAGCTACACGTCATTGCCTTGGAGGGTTCGTTATTTG ATGAGG BIP CACAATGGGACTGAGACACGGAGCTTTCGCTCATTGT GAA LF CCTACCAACTAGCTGATATGGC LB TACTCCTACGGGAGGCAG H. SET 1 F3 TGGGTGTGAACCATGAGA sapiens GAPDH B3 AGTCCTTCCACGATACCAA FIP TCCATAGGGTGCCAGGCTGTATGACAACAGCCTCA AGAT 13IP CTTTCTTTGCAGCAATGCCTCCAGTTGTCATGGATGA CCTTG LF CTG CCT TCC TCA CCT GAT G LB TGC ACC ACC AAC TGC TTA SET 2 F3 CCCCAAAGGCCAGGCT B3 AGAAGGGATGGGAGAGAGC FIP GGAATGGGGAGAAGGGCAGGTTAAATGTCACCGGGA GGATTG 131P CGGAAACCAGATCTCCCACCGGCTACAGAAAGGTCA GCAGC SET 3 F3 ATCAAGTGGGGCGATGCT B3 GGGCAGAGATGATGACCCT FIP GCACTCACCCCAGCCTTCTCGCTGAGTACGTCGTGG AGT BIP AAGCTGACTCAGCCCTGCAAACCCTGCAAATGAGCCT ACA F3 GTT GAC CCG ACC CCA AAG B3 AAG GGA TGG GAG AGA GCC FIP CGG AAT GGG GAG AAG GGC AGA TGT CAC CGG GAG GAT TGG BIP CGG AAA CCA GAT CTC CCA CCG CCA GCT ACA GAA AGG TCA GC